Paroxysmal dyskinesias (PDs) are a group of central nervous system diseases characterized by episodes of abnormal involuntary hyperkinetic movement without altered consciousness that increasingly have been recognized in dogs.To present the phenotypical characterization, treatment, and outcome of a PD observed in Maltese dogs.
Chicken C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ch-48T |
DL Develop |
48T |
EUR 508 |
- Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Chicken C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ch-96T |
DL Develop |
96T |
EUR 661 |
- Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Hu-48T |
DL Develop |
48T |
EUR 385 |
- Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Hu-96T |
DL Develop |
96T |
EUR 492 |
- Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Mouse C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-p-48T |
DL Develop |
48T |
EUR 547 |
- Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-p-96T |
DL Develop |
96T |
EUR 715 |
- Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ra-48T |
DL Develop |
48T |
EUR 426 |
- Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Ra-96T |
DL Develop |
96T |
EUR 549 |
- Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rabbit C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Rb-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Rabbit C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Rb-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Bovine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Bovine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ch-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ch-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 388 |
Human C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 533 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Rat C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 437 |
Rat C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 603 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Bovine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Bovine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ch-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Chicken C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ch-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 372 |
Human C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 510 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Porcine C Reactive Protein (CRP) ELISA Kit |
RD-CRP-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Rat C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 419 |
Rat C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 577 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rabbit C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Gu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Gu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids. |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Gu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Gu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Gu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Guinea pig C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Gu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
CRP C-Reactive Protein Human |
PROTP02741-1 |
BosterBio |
Regular: 1mg |
EUR 317 |
Description: Human CRP produced in Human plasma having a molecular mass of 114 kDa. ;It can be used as a marker for inflammation and also used for monitoring and prediction of future events in coronary artery disease. |
TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-D10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-H10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack |
CRP-RDT-H25 |
Alpha Diagnostics |
1 pack |
EUR 293 |
TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-M10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack |
CRP-RDT-M25 |
Alpha Diagnostics |
1 pack |
EUR 293 |
TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack |
CRP-RDT-R10 |
Alpha Diagnostics |
1 pack |
EUR 171 |
TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack |
CRP-RDT-R25 |
Alpha Diagnostics |
1 pack |
EUR 293 |
Anti-C Reactive Protein/Crp Antibody |
A00249-1 |
BosterBio |
100ug/vial |
EUR 334 |
CRP C-Reactive Protein Rat Recombinant Protein |
PROTP48199-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: CRP produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 217 amino acids (20-230 a.a.) and having a molecular mass of 24.1kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40 kDa).;CRP is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Human C-Reactive Protein (CRP) AssayMax ELISA Kit |
EC1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat C-Reactive Protein (CRP) AssayMax ELISA Kit |
ERC1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit |
EMC1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
CRP siRNA |
20-abx901269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRP Antibody |
BF0116 |
Affbiotech |
200ul |
EUR 376 |
Description: CRP antibody detects endogenous levels of total CRP. |
CRP Antigen |
E64C00501 |
EnoGene |
1mg |
EUR 700 |
CRP Antigen |
E64C00502 |
EnoGene |
1mg |
EUR 700 |
CRP Protein |
abx069766-50ml |
Abbexa |
50 ml |
EUR 1205 |
- Shipped within 5-10 working days.
|
CRP siRNA |
20-abx912842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRP siRNA |
20-abx912843 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRP Antiboday |
70R-51961 |
Fitzgerald |
100 ug |
EUR 197 |
Description: Purified Rabbit CRP antibody |
CRP protein |
80R-4350 |
Fitzgerald |
50 ug |
EUR 349 |
Description: Purified Recombinant CRP protein (His tagged) |
CRP antibody |
70R-4527 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CRP antibody raised against the N terminal of CRP |
CRP antibody |
10C-CR2015M1 |
Fitzgerald |
1 mg |
EUR 168 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10C-CR2015M5 |
Fitzgerald |
1 mg |
EUR 165 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10C-CR2015M6 |
Fitzgerald |
1 mg |
EUR 165 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-10264 |
Fitzgerald |
50 ug |
EUR 241 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-1042 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-2276 |
Fitzgerald |
100 ug |
EUR 221 |
Description: Recombinant Fab monoclonal CRP antibody |
CRP antibody |
10-2349 |
Fitzgerald |
1 mg |
EUR 349 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-2350 |
Fitzgerald |
1 mg |
EUR 349 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-2703 |
Fitzgerald |
1 mg |
EUR 165 |
Description: Mouse Monoclonal CRP antibody |
CRP antibody |
10-7893 |
Fitzgerald |
1 mg |
EUR 392 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-7894 |
Fitzgerald |
1 mg |
EUR 403 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C189A |
Fitzgerald |
1 mg |
EUR 245 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C189B |
Fitzgerald |
1 mg |
EUR 420 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33A |
Fitzgerald |
1 mg |
EUR 238 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33AS |
Fitzgerald |
1 mg |
EUR 235 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33B |
Fitzgerald |
1 mg |
EUR 662 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-C33C |
Fitzgerald |
1 mg |
EUR 245 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-8426 |
Fitzgerald |
100 ul |
EUR 393 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10-1004 |
Fitzgerald |
1 mg |
EUR 457 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-C189a |
Fitzgerald |
1 mg |
EUR 284 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
10R-C189b |
Fitzgerald |
1 mg |
EUR 399 |
Description: Mouse monoclonal CRP antibody |
CRP protein |
30C-CP1000U |
Fitzgerald |
1 mg |
EUR 349 |
Description: Purified native Human CRP protein |
CRP protein |
30R-2081 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human CRP protein |
CRP protein |
30R-2389 |
Fitzgerald |
250 ug |
EUR 152 |
Description: Purified recombinant Human CRP protein |
CRP protein |
30R-2740 |
Fitzgerald |
10 ug |
EUR 341 |
Description: Purified recombinant Human CRP protein |
CRP protein |
30R-2984 |
Fitzgerald |
1 mg |
EUR 380 |
Description: Purified recombinant Human CRP protein |
CRP Protein |
30R-3412 |
Fitzgerald |
1 mg |
EUR 300 |
Description: Human C-reactive protein |
CRP protein |
30R-AC001x |
Fitzgerald |
10 mg |
EUR 457 |
Description: Highly purifed Human CRP protein |
CRP protein |
30R-AC067 |
Fitzgerald |
1 mg |
EUR 448 |
Description: Purified native Human CRP protein |
CRP Antibody |
31062-100ul |
SAB |
100ul |
EUR 252 |
CRP Antibody |
31062-50ul |
SAB |
50ul |
EUR 187 |
CRP protein |
30-1092 |
Fitzgerald |
1 mg |
EUR 393 |
Description: Purified recombinant Human CRP protein |
CRP protein |
30-1094 |
Fitzgerald |
100 ug |
EUR 155 |
Description: Purified native Human CRP protein |
CRP protein |
30-1906 |
Fitzgerald |
1 mg |
EUR 336 |
Description: Native human CRP protein |
CRP protein |
30-AC05 |
Fitzgerald |
5 mg |
EUR 277 |
Description: Highly purified Human CRP protein |
CRP protein |
30-AC07 |
Fitzgerald |
5 mg |
EUR 1029 |
Description: Purified Recombinant CRP protein |
CRP protein |
30-AC10 |
Fitzgerald |
5 mg |
EUR 250 |
Description: Partially purified Human CRP protein |
CRP Antibody |
32023-100ul |
SAB |
100ul |
EUR 252 |
CRP antibody |
10R-3002 |
Fitzgerald |
100 ug |
EUR 265 |
Description: Mouse monoclonal CRP antibody |
CRP antibody |
20C-CR2015S |
Fitzgerald |
1 ml |
EUR 133 |
Description: Sheep polyclonal CRP antibody |
CRP antibody |
20C-CR2015SP |
Fitzgerald |
1 ml |
EUR 177 |
Description: Sheep polyclonal CRP antibody |
CRP antibody |
20-1002 |
Fitzgerald |
1 ml |
EUR 111 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-1003 |
Fitzgerald |
1 ml |
EUR 133 |
Description: Rabbit polyclonal Human CRP antibody |
CRP antibody |
20-1262 |
Fitzgerald |
1 ml |
EUR 647 |
Description: Sheep polyclonal CRP antibody |
CRP antibody |
20-B9007G000-W0 |
Fitzgerald |
10 ml |
EUR 116 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-B9007GD00-D0 |
Fitzgerald |
5 mg |
EUR 138 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3903GND1-D0 |
Fitzgerald |
1 ml |
EUR 133 |
Description: Polyclonal CRP antibody |
CRP antibody |
20-S3903GND9-D0 |
Fitzgerald |
10 ml |
EUR 127 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3911G000-S4 |
Fitzgerald |
10 ml |
EUR 116 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3911G000-V0 |
Fitzgerald |
10 ml |
EUR 133 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S3911G001-V0 |
Fitzgerald |
10 ml |
EUR 133 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
20-S6011G000-S4 |
Fitzgerald |
10 ml |
EUR 138 |
Description: Goat polyclonal CRP antibody |
CRP antibody |
70R-13710 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Sheep polyclonal CRP antibody |
CRP antibody |
70-B9007GA00-A0 |
Fitzgerald |
5 mg |
EUR 241 |
Description: Goat polyclonal Human CRP antibody |
CRP antibody |
70R-10663 |
Fitzgerald |
1 ml |
EUR 484 |
Description: Rabbit polyclonal CRP antibody |
CRP Antibody |
DF6027 |
Affbiotech |
200ul |
EUR 304 |
Description: CRP Antibody detects endogenous levels of total CRP. |
CRP Antibody |
1-CSB-PA005116 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CRP. Recognizes CRP from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
CRP Antibody |
1-CSB-PA790121 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
crp Antibody |
1-CSB-PA359785LA01ENV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against crp. Recognizes crp from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA |
CRP Antibody |
1-CSB-PA181901 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300 |
CRP Antibody |
1-CSB-PA06079A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
anti-CRP |
YF-PA27200 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CRP |
Polyclonal CRP Antibody |
APG02787G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRP . This antibody is tested and proven to work in the following applications: |
Large-CRP OmcBProtein |
20-abx600013 |
Abbexa |
-
EUR 843.00
-
EUR 439.00
-
EUR 1274.00
-
EUR 1636.00
-
EUR 551.00
|
-
100 ug
-
10 ug
-
200 ug
-
500 ug
-
50 ug
|
|
Large-CRP OmcBProtein |
20-abx600014 |
Abbexa |
|
|
|
CRP Blocking Peptide |
BF0116-BP |
Affbiotech |
1mg |
EUR 195 |
CRP Conjugated Antibody |
C31062 |
SAB |
100ul |
EUR 397 |
CRP Conjugated Antibody |
C32023 |
SAB |
100ul |
EUR 397 |
CRP cloning plasmid |
CSB-CL005991HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 276
- Sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacac
- Show more
|
Description: A cloning plasmid for the CRP gene. |
CRP cloning plasmid |
CSB-CL005991HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 141
- Sequence: atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
|
Description: A cloning plasmid for the CRP gene. |
CRP cloning plasmid |
CSB-CL005991HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 675
- Sequence: ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACAC
- Show more
|
Description: A cloning plasmid for the CRP gene. |
anti- CRP antibody |
FNab01994 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IF: 1:50 - 1:200
- Immunogen: C-reactive protein, pentraxin-related
- Uniprot ID: P02741
- Gene ID: 1401
- Research Area: Immunology, Cardiovascular
|
Description: Antibody raised against CRP |
anti- CRP antibody |
FNab01995 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:1000-1:4000
- IHC: 1:50-1:500
- Immunogen: C-reactive protein, pentraxin-related
- Uniprot ID: P02741
- Gene ID: 1401
- Research Area: Immunology, Cardiovascular
|
Description: Antibody raised against CRP |
CRP Polyclonal Antibody |
ES3926-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CRP Polyclonal Antibody |
ES3926-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CRP Polyclonal Antibody |
ABP52927-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CRP
- Applications tips:
|
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP |
CRP Polyclonal Antibody |
ABP52927-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CRP
- Applications tips:
|
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP |
CRP Polyclonal Antibody |
ABP52927-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CRP
- Applications tips:
|
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP |
Human CRP Protein |
abx060113-1mg |
Abbexa |
1 mg |
EUR 453 |
- Shipped within 5-10 working days.
|
Human CRP Protein |
abx060138-1mg |
Abbexa |
1 mg |
EUR 453 |
- Shipped within 5-10 working days.
|
Human CRP Protein |
abx060712-1mg |
Abbexa |
1 mg |
EUR 704 |
- Shipped within 5-10 working days.
|
Human CRP Antibody |
abx023919-10ml |
Abbexa |
10 ml |
EUR 356 |
- Shipped within 5-10 working days.
|
CRP Rabbit pAb |
A0224-100ul |
Abclonal |
100 ul |
EUR 308 |
CRP Rabbit pAb |
A0224-200ul |
Abclonal |
200 ul |
EUR 459 |
CRP Rabbit pAb |
A0224-20ul |
Abclonal |
20 ul |
EUR 183 |
CRP Rabbit pAb |
A0224-50ul |
Abclonal |
50 ul |
EUR 223 |
CRP Polyclonal Antibody |
A52500 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
crp Polyclonal Antibody |
A55435 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CRP Rabbit pAb |
A15659-100ul |
Abclonal |
100 ul |
EUR 308 |
CRP Rabbit pAb |
A15659-200ul |
Abclonal |
200 ul |
EUR 459 |
CRP Rabbit pAb |
A15659-20ul |
Abclonal |
20 ul |
EUR 183 |
CRP Rabbit pAb |
A15659-50ul |
Abclonal |
50 ul |
EUR 223 |
CRP Blocking Peptide |
33R-5929 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRP antibody, catalog no. 70R-4527 |
CRP calibrator set |
35-S6021H000-L4 |
Fitzgerald |
5 ml |
EUR 133 |
Description: C-reactive Protein Calibrator Set |
CRP Polyclonal Antibody |
41605-100ul |
SAB |
100ul |
EUR 252 |
CRP Polyclonal Antibody |
41605-50ul |
SAB |
50ul |
EUR 187 |
CRP, human recombinant |
4863-10 |
Biovision |
|
EUR 256 |
CRP, human recombinant |
4863-1000 |
Biovision |
|
EUR 5270 |
CRP, human recombinant |
4863-50 |
Biovision |
|
EUR 588 |
CRP, human recombinant |
4864-1000 |
Biovision |
|
EUR 332 |
CRP, human recombinant |
4864-250 |
Biovision |
|
EUR 147 |
CRP monoclonal antibody |
10R-11480 |
Fitzgerald |
1 mg |
EUR 354 |
Description: Mouse anti-human C-reactive protein monoclonal antibody |
Anti-CRP Purified |
11-480-C100 |
ExBio |
0.1 mg |
EUR 204 |
Anti-CRP Purified |
11-484-C100 |
ExBio |
0.1 mg |
EUR 204 |
Anti-CRP Purified |
11-537-C100 |
ExBio |
0.1 mg |
EUR 204 |
Anti-CRP Biotin |
1B-484-C100 |
ExBio |
0.1 mg |
EUR 286 |
CRP protein (Canine) |
30-1093 |
Fitzgerald |
100 ug |
EUR 702 |
Description: Purified native Canine CRP protein |
CRP antibody (FITC) |
60R-2348 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CRP antibody (FITC) |
CRP Antibody, HRP |
60R-2349 |
Fitzgerald |
100 ug |
EUR 332 |
Description: Rabbit polyclonal CRP antibody (HRP) |
CRP ELISA kit |
55R-IB59126 |
Fitzgerald |
96 wells |
EUR 378 |
Description: ELISA kit for the detection of CRP in the research laboratory |
CRP ELISA kit |
55R-IB79102 |
Fitzgerald |
96 wells |
EUR 579 |
Description: ELISA kit for the detection of CRP in the research laboratory |
Client-owned Maltese dogs (n = 19) with presumed diagnosis of PD.Data were collected retrospectively from medical records (2014-2019), and supporting information was added prospectively by using a questionnaire directed to the owners of the affected dogs.The episodes were characterized mainly by sudden dystonia of ≥1 limbs and generalized body tremors with preserved consciousness.